Codons K13 (AAA) and D384 (GAC) were targeted for change to arginine (AGA)(p.K13R) and valine (GTG)(p.D384V) by sgRNAs (targeting AGATCGTTAGCAGAAACAAA and ATTCTCTGGATCAGAGTCAG) and ssODN templates (TTCTTCAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCAGAAACAGAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTGTATCCATTTCTGCGGCTGT and ATCAGACTTTTGTAATTTGTGAATGCTGATCTTCATCAAAAGGTTCATTCTCTGGATCAGCGTCAGCGGCGTCAGCATATCTATAATGATCAGGTTCATTGTCACTAACATCTGGAGTCACAGAAGTTGAACTGCT) using CRISPR/Cas9 technology. The lysine-to-arginine mutation prevents ubiquination of the residue and thus nuclear localization of the peptide. The aspartic acid-to-valine mutation interferes with the phosphorylation of the C-terminal tail of the peptide. (J:264011)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count