Phenylalanine and leucine codons 122 (TTC) and 123 (CTT) were targeted for change to glycine codons (GGT)(p.F122_L123delinsGG) with an sgRNA (targeting TAATACGACTCACTATAGGTGGGGATCTCATTGTTCAAAGTTTTAGAGCTAGAAATAGCA) and an ssODN template (GTTTCCTGCCACAGGGTCATGCTCTTTAAGCTCTCAGAAGAAGTGAGCGAGTTGGAATTGAGATCTTTTAAAGGTGGTTTGAACAATGAGATCCCCAAATGTAAGCTGGAAGATGACTTGGTAAGACCTAATCTCCTGAAGATGGGTCACCTCTGG) using CRISPR/Cas9 technology. These mutations create an oligomerization-deficient form of the encoded peptide. (J:296046)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count