CRISPR/cas9 mediated recombination using a single guide RNA (AGATGTGAGGGATGTGCCCAAG) introduced a c.13198G>A in exon 76. The introduced mutation was designed to be homologous to the c.12838G>A identified in a human patient with multiple morphological abnormalities of the sperm flagella (MMAF). Immunostaining indicated reduced levels of expression in testes and spermatozoa from homozygous males. (J:311550)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count