Threonine codons 305 and 314 and serine codon 312 were targeted for change to alanine (p.T305A, p.S312A, p.T314A) with a gRNA (targeting ACACCAAGCGGTCTCTGGTAGG) and an ssODN (GAACCAGTGAAAACCAAGACAAGGACTTTTAATGTAAACGCCGGCAGTCTACTCCTGCCTGCTGACGCCAAGCGGTCTCTGGTAGGTGGCTAACCTTTCCTACCGAATCTTGTTTAAGA) using CRISPR/Cas9 technology. These mutations make the encoded amino acids unphosphorylatable. (J:310821)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count