Gmeb2^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCTGACGAGTCTGAGATGAT and CCAAGAATCCGGTAGAGAAC, which resulted in a 363 bp deletion beginning at Chromosome 2 position 180,902,064 bp and ending after 180,902,426 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001242983 (exon 5) and 259 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 119 and early truncation 13 amino acids later. (J:188991)