Fbrs^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCGAGACCGGATTCTCTGCA and AACCTTCTACTCCCATGCCG, which resulted in a 1748 bp deletion beginning at Chromosome 7 position 127,083,557 bp and ending after 127,085,304 bp (GRCm39/mm39). This mutation deletes ENSMUSE00001370970, ENSMUSE00001372570, ENSMUSE00000890591, ENSMUSE00000632361, and ENSMUSE00000632360 (exons 7-11) and 1036 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 347 and early truncation 9 amino acids later. (J:188991)