Sequence upstream of exon 1 and in intron 8 were targeted with a pair of sgRNAs (targeting (1) TCCACTTCTCTAGTGCTAGG and (3) AGGCAGCTACACCACCCTCC), resulting in the deletion between sgRNA targets 1 and 3 containing exons 1-8. The ESCs used for the creation of this allele also contain the Tg(CAG-EGFP,Acr-EGFP)2Osb double transgene. (J:306305)
Basic Information
(129S2/SvPas x C57BL/6NSlc)F1-Tg(CAG-EGFP,Acr-EGFP)2Osb
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count