Introns 1 and 2 were targeted with two sgRNAs (targeting GCTCAGGAAGCAGCCGCTTG and TAAATCCTATCTCCGGTCCC) and tracrRNAs and crRNA using CRISPR/Cas9 technology, resulting in a 2172 bp deletion that includes exon 2. Immunoblots confirmed the absence of peptide expression from this allele. (J:306305)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count