Exons 3 and 13 (or 12, depending on splice variant) were targeted with two sgRNAs (targeting TCCATGTCCGCCAGTAGTTC and AAAAAGAGCTATTACCCTAA) and tracrRNAs and crRNA using CRISPR/Cas9 technology, resulting in a 9620 bp deletion from the 3' end of exon 3 to the 5' end of exon 13 (12). Immunoblots confirmed the absence of peptide expression from this allele. (J:306305)