Lysine codon 133 was targeted with an sgRNA (targeting CATATGGGTCCGACAGCACG) and an ssODN template (CTGCTGGTGTGTGACGTTCCCATTAGACAACTGCACTACAGGCTCCGAGATGAACAACAAAGAAGTCTCGTGCTGTCGGACCCATATGAGCTGAAAGCTCTCCACCTCAATGGACAGAATATCAACCA) using CRISPR/Cas9 technology, resulting in its change to an arginine codon (p.K133R) owing to an A-to-G nucleotide mutation. This change prevents ubiquitylation at amino-acid residue 133. (J:306336)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count