This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCAGAATTGAAGATCCAGT and CCATGACAGTGATATCATCC, which resulted in a 1510 bp deletion beginning at Chromosome 8 position 105,320,175 bp and ending after 105,321,684 bp (GRCm39/mm39). This mutation deletes 1510 bp from ENSMUSE00000334359 (exon 2) and is predicted to cause a change of amino acid sequence after residue 7 and termination 41 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count