Exon 1 was targeted with two sgRNAs (targeting GTTGGACCGGGACTCCTGCT and CGTGGACCCGCTGGAGCAAG) using CRISPR/Cas9 technology, resulting in a 32 bp deletion (CCCGGTCCAACCGTGGACCCGCTGGAGCAAGT) that causes a frameshift and premature stop codon (p.(Pro44Glyfs*13)). Western blot experiments confirmed the absence of full-length peptides in the testes. (J:307600)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count