Tmem212^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATGTAGAGGGCACAAC and TCGTGACCTAACAGGAGCGG, which resulted in a 2249 bp deletion plus a 1 base pair insertion (T) beginning at Chromosome 3 position 27,938,683 bp and ending after 27,940,931 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000364670, ENSMUSE00000409111 (exons 2 and 3) and 1866 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later. (J:188991)