Rassf10^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTCTTCTCCGAAGGATCCA and TACACAAGGGATTCACACAC, which resulted in a 1510 bp deletion beginning at Chromosome 7 position 112,553,404 bp and ending after 112,554,913 bp (GRCm39/mm39). This mutation deletes 1510 ENSMUSE00001243839 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and termination 11 amino acids later. (J:188991)