This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGTCTTCCGTTGAAACCGA and GATTGCACCACTCCTGAAAA, which resulted in a 776 bp deletion beginning at Chromosome 7 position 48,097,004 bp and ending after 48,097,779 bp (GRCm39/mm39). This mutation deletes 776 bp from ENSMUSE00000593974 (exon 2) and is predicted to cause a change of amino acid sequence after residue 44 and termination 15 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count