A G-to-A mutation was introduced to change arginine codon 47(CGC) to a histidine codon (CAC) (p.R47H) using an sgRNA (targeting ACTGGGGGAGACGCAAGGCC) and an ssODN template (CTGCAGGGCATGGCCGGCCAGTCCTTGAGGGTGTCATGTACTTATGACGCCTTGAAGCACTGGGGGAGACaCAAGGCCTGGTGTCGGCAGCTGGGTGAGGAGGGCCCATGCCAGCGTGTGGTGAGCACACACGGTGTGTGGCTGC) with CRISPR/Cas9 technology. The mutation has been indicated as an Alzheimer's Disease risk factor. (J:308299)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count