This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATTCCCTGGAATCATT and TCCGTCTGACTCCTTTCCAG, which resulted in a 5037 bp deletion beginning at Chromosome 15 position 25,991,444 bp and ending after 25,996,480 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000562948, ENSMUSE00000562947 (exons 4 and 5) and 4780 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 351 and early truncation 3 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count