Zcchc3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCAGCGTGGCGGGGCACTGA and CATGGCCACCGGCGGCGGAG, which resulted in a 1232 bp deletion beginning at Chromosome 2 position 152,255,469 bp and ending after 152,256,700 bp (GRCm39/mm39). This mutation deletes 1232 bp from ENSMUSE00000640007 (exon 1) from 2 nucleotides before the ATG start and 26 nucleotides after the TGA stop and should result in a null allele. (J:188991)