Magi3^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCAGGGTGTGAGAAAAACAC and TTTAGGAATGGAGCACAAAA, which resulted in a 7616 bp deletion beginning at Chromosome 3 position 103,956,433 bp and ending after 103,964,048 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000421484, ENSMUSE00000421384, ENSMUSE00000421452, and ENSMUSE00000421379 (exons 8-11) and 6694 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 361 and early truncation 14 amino acids later. (J:188991)