This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAATGGCGCCTGGACAGAG and GGGTGAAGCCCCAAGTTCCC, which resulted in a 2435 bp deletion beginning at Chromosome 18 position 37,847,990 bp and ending after 37,850,424 bp (GRCm39/mm39). This mutation deletes 2435 bp from ENSMUSE00001346069 (exon 1) including the start site but leaves the last 3 nucleotides before the end of the exon, and is predicted to result in a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count