Isoleucine codon 65 in exon 4 was targeted with sgRNAs (targeting TGTTTCAGGCTCAGAAATCCNGG and ATAAAATGCTCTTTCAATCCNGG ) and an ssODN (ATGGGGGTCTTTGGTGCTCGGTATGATGTGAACACATTCTCTTTTATAAAATGCTCTTTCCATCCAAGACTTCTGAGCCTGAAACAAAACGAGAGAGAGAGAAAAAAAGATGAATATAAATTTTAAATCT ) using CRISPR/Cas9 technology, resulting in a T-to-G mutation (c.195T>G) that changes it to a methionine codon (p.I65M). This mutation mimics a mutation associated with early-onset or pediatric cataract in humans. (J:307352)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count