CRISPR/Cas9 endonuclease-mediated genome editing is used to create a F352V missense mutation (TTT to GTT). Guide RNAs (TTCTCAGATTCAGTAAAATC and ATTTTACTGAATCTGAGAAG) were selected to target position 352 of exon 2. The mutation corresponds to a human mutation associated with decreased susceptibility to late-onset Alzheimer's disease. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count