CRISPR/Cas9 endonuclease-mediated genome editing is used to introduce encoding a S370C missense mutation (TCC to TGC). Additionally, the following silent nucleotide change was included for targeting efficiency (L370L [CTC to CTT]. Guide RNAs (GACTTTTTTGCTCTCTCCTT and AAAGCTCAAGGTTGGTCCGA) were selected to target position 370 of exon 2. The mutation that corresponds to the human C370 codon associated with late-onset Alzheimer's disease. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count