Arginine codon 216 (CGG) in exon 4 was targeted for a change to histidine (CAC) (p.R216H) using an sgRNA (targeting GAAATACATTAGCTGCCGGCTGG) and an ssODN (GAGGCTGAAGTAATAGCTCAAGTAGATACATGCCAACAGTATAACCACAAATGTCACCAGGTGGCAGCTAATGTATTTCATGATTAAATGACTAGAGTTCTTTTTTGTCTTCAAGTACTGCTC). The mutated amino-acid is conserved between human and mice and the mutation is found in a patient with symptoms of primary ovarian failure, severe intellectual disability, sensorineural hearing loss, and kyphosis. (J:307589)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count