A C was inserted into exon 16 (c.8137insC) using an sgRNA (targeting ATCAAGAACAAGTTATCTGCTGG) and an ssODN (AGCAGTACTAAGACCAAAATCAAGAACAAGTTAagcGCTGGAGAGAAAAcCTCCAAGAGAGAGCAGACCAAAACCGCCCTTGGGCTGCCACAAACTCCAC) with CRISPR/Cas9 technology. This mutation mimics a mutation found in multiple morphological abnormalities of the sperm flagella (MMAF) patients. Reduced transcript expression was confirmed by RT-qPCR and absence of peptide expression by immunostaining. (J:307606)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count