Codons Arg428Ala429 (CGGGCA) were changed to GlnVal (CAGGTT) (p.428_429delinsQV) using two sgRNAs (targeting GGCTGAAGTAGGCATCTGCC and CTCACAGCTGGAGCACTTGC) and an ssODN (GTGGTCAAGCAGGAAGGAGGTGACAATGACCTTATAGAGCGCATCCAGGTTGACGCCTACTTCAGCCCCATCCACTCACAGCTGGAGCACTTGCTGGAC) with CRISPR/Cas9 technology. This mutation in the active domain mimics the sequence in the human ortholog, thought to be associated with the lower stability/activity of the enzyme in modern humans compared to other tetrapods, other primates and human ancestors. (J:307180)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count