Exon 2, containing the ATG start codon, was targeted with two sgRNAs (targeting TTTGTCAAACCATGGAAGTGGGG and CCGCCCACCTGATGGATGAAGGG) using CRISPR/Cas9 technology, resulting in a 73 bp deletion. Absence of peptide expression from this allele was confirmed by immunoblot experiments with brain extracts. (J:306957)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count