A 9 bp in-frame deletion was introduced in the sequence encoding the 7th zinc finger using an sgRNA (targeting GCCCCTGCTTGTGATCACTTTGG) and an ssODN template with CRISPR/Cas9 technology. The deletion removes phenylanaline codon 755, glycine 756 and asparagine 757. (J:306576)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count