Codon changes to change phenylalanine 755 and glycine 756 to alanines (TTT>GCT (p.F755A), GGC>GCC (p.G756A)) were introduced using CRISPR/Cas9 technology with Alt-R CRISPR RNA (targeting GCCCCTGCTTGTGATCACTT), Alt-R trans-activating CRISPR RNA, high-fidelity Cas9 nuclease ribonucleoprotein and an ssODN template (ACGCCTGAAGAGCCCCCTAAACAGCGCTGCCGGGCCCCTGCTTGTGACCACGCTGCCAATGCCAAGTGTAATGGTTACTGCAATGAGTGCTACCAGTTCAAGCAGATGTATGG). This allele was generated in fertilized oocytes heterozygous for the Tnfaip3tm4.1Ama allele. Separate single-mutant for this Tnfaip3em2Ama allele and double-mutant mouse lines were subsequently established. (J:306576)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count