A single nucleotide was duplicated in the coding region of exon 5 (c.1380dupT) using an sgRNA (targeting TTCGATGACGAGTCCATGCAAGG) and an ssODN template with CRISPR/Cas9 technology. This insertion creates a premature stop codon TAA and prevents translation of most of the sequence coding for the dentin phosphoprotein (DPP) domain. (J:326944)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count