CRISPR/Cas9 technology using sgRNAs CCTTAGTATGTGATATACCTCAA and CCCGTACTCTTGTTCTAGGATGC deleted the entire gene complex. PCR and Northern blot analysis confirmed the absence of expression upon paternally inherited deletion, while expression remains unaffected upon maternal transmission of the allele. (J:305741)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count