Exon 2 was targeted with an sgRNA (targeting TGATGGATATGAGTGAACTTGG) and an ssODN containing three poly(A) signals flanked by homology arms using CRISPR/Cas9 technology. In the resulting allele transcription is disrupted by the insertion of premature poly(A) signals in exon 2. (J:285433)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count