The 3' end of exon 3 was targeted with an sgRNA (targeting AGGCCGCATACTGATGAAAGAGGT which includes the splice donor site) using CRISPR/Cas9 technology, resulting in a 36 bp deletion that includes exonic and intronic sequence and the exon 3 splice donor site. RT-PCR experiments show that owing to the deleted splice site, exon 3 is skipped during mRNA splicing. Immunofluorescence experiments confirm the absence of peptide expression from this allele. (J:285572)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count