Guide RNAs (gaacgccggagtgattgagc and atgctgtgtacatcaatctc) are designed to delete 109 base pairs in exon 7. Exon 7 in humans contains a disease-causing mutation present in multiple families with intellectual disability (ID). Western blot analysis confirms the absence of protein in brain lysates. (J:304877)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count