Exon 2 was targeted with two sgRNAs (targeting ACGCTTAAATTTGAAGATGCTGG and CGAGTTAAAGTTGGACGTTCTGG) using CRISPR/Cas9 technology, resulting in a 156 bp deletion that includes the start codon. Absence of exon 2 expression in the hippocampus was confirmed by RT-PCR. (J:285279)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count