CRISPR/Cas9 technology using sgRNA3 (CTGGCCCTAAAATCAAGCCTTGG) and sgRNA9 (AGGACTTCGGGAGTGGTAAATGG) located in the nonconserved region between intron 5 and intron17 generated a deletion of exons 5 to 16. The pound (#) symbol is used for the pool of several founders. (J:304107)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count