CRISPR/Cas9 technology using sgRNAs targeting exon 3 (ttctaatcgtaactgtggcctgg) and exon 4 (tacacttgccttgctcaacctgg) deleted part of exon 3 and 4 (20 nucleotides of exon 3, 2.2 kb intron, and 47 neucleotides of exon 4), starting at the codon that encodes A88 in the second transmembrane domain, resulting in an out-of-frame truncation. (J:304120)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count