The 3' UTR (in exon 12) of Ddx19a and exon 6 of Ddx19b were targeted using two pairs of TALENs (targeting TGGTACGGGTAAAACAGCTG, TGCAGGCTCTACTTGGCTGA, TAGCCCTGGCTTGGTGTGGT, TCTACCCTCCAAGTGCTG), resulting in the deletion of 30,919 bp of sequence including the 5' end of Ddx19a and 3' end of Ddx19b. (J:289833)
Basic Information
Intergenic deletion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count