Exon 2 was targeted with a gRNA (targeting TTCGGACCGATTGTCAACGA) and an ssODN that introduces stop codons in all three reading frames (TAACTAGATGA), using CRISPR/Cas9 technology. Immunochemistry experiments confirmed the lack of peptide expression from this allele in the brain. (J:303506)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count