CRISPR/cas9 genome editing is used to target intronic DNA flanking exon 2 (guide RNAs - AAGTGTCCCCAAATATTGTC ; GCACCTAGCACATTGCCATG). DNA sequencing of the targeted region identified a 3,527-nt deletion (AGTATAAGTGTCCCCAAAT//3527 deletion//GGTCAGGGATCGATAGTTGACAAG) that results in loss of exon 2 from the genome. (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count