A mutation that changes codon 96 from cysteine (TGC) to alanine (GCC) (p.C96A) was created with two gRNAS (targeting GAGAGCTGCGCTCGCGACGGTTA and AAGCCTATCTCTGACTCAGTCGG) and an ssODN template using CRISPR/Cas9 technology. The mutation mimics the human p.C97A gain-of-function mutation that results in a hyperactivated channel activity. (J:284475)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count