The gene was targeted with a crRNA/tracrRNA duplex (targeting TTCGGTCCCTTCGTTTCGAA) and an ssODN template (CCGGAAAGGATTCTTCGGTCCCTTCGTTTCCTACAACAGCTTAATTAAGGTTTAAACGCCATGACGAAAGGCCCCCCGGAGAAGCCGCCGCCGCCAGAGA) using CRISPR/Cas9 technology, resulting in the creation of premature stop codons in all three reading frames. Peptide expression from this alleles was absent from mouse embryo fibroblasts (MEFs). (J:297179)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count