A single A-to-G mutation was introduced to change codon 42 from lysine (AAG) to glutamic acid (GAG) (p.K42E), using a gRNA (targeting TCGCTATGCCAAGAAGTGTCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics one associated with an autosomal recessive form of retinitis pigmentosa (RP59) in humans. (J:303192)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count