Exon 3 (containing the start codon) was targeted with a gRNA (targeting AGTGAAGTGCACAACGAAGACGG) using CRISPR/Cas9 technology, resulting in a 2 bp deletion (AA). Immunoblots of brain and spinal cord lysates confirm the absence of peptide expression from this allele. (J:288278)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count