Spi1^em1Aduci

Guide RNAs (GCTATGCTTAAGTCAGGCTT and ATTGTGGCTATGCTTAAGTC) are designed to create a C to T missense mutation resulting in a mutation orthologous to the location of human SNP rs1377416. Human SNP rs1377416 has been found in human SPI1 and is a functional variant that is active in human myeloid cells and in the brain of a mouse model of Alzheimer's disease (AD). (J:101977)