Guide RNAs (GCTATGCTTAAGTCAGGCTT and ATTGTGGCTATGCTTAAGTC) are designed to create a C to T missense mutation resulting in a mutation orthologous to the location of human SNP rs1377416. Human SNP rs1377416 has been found in human SPI1 and is a functional variant that is active in human myeloid cells and in the brain of a mouse model of Alzheimer's disease (AD). (J:101977)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count