CRISPR/cas9 mediated recombination created a deletion in exon 1. Using the forward primer TGAAGCATCCCAAGAAATCC and the reverse primer CACAGTCCTGTCCTGGTGTG the sequence remaining in the targeted region is GCACACTGCCTCTGAGATGA. Expression is reduced by more than 90% in cultured adult dorsal root ganglion cells from homozygous mice. (J:268832)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count