Exon 2, containing the CDS, was targeted with two sgRNAs (targeting AGACAGGCAGTCTCGAGTTC and GGGGAAGAGTACTTTCTATG) using CRISPR/Cas9 technology, resulting in a 1258 bp deletion (including the entire exon). Lack of transcript expression from this allele was confirmed by qRT-PCR. (J:299874)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count