CRISPR/Cas9 technology using sgRNA GACTTCGGAGGTGTCGATGG inserted a single nucleotide (C) in exon 1 resulting in a premature stop codon ten amino acids downstream of the inserted nucleotide. Immunostaining confirmed absence of protein expression in the tongue. (J:297664)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count