Using a crRNA (targeting TGAAGTCCTTGATGATCCTG), tracrRNA and an ssODN template (GTCATTGTCCTGGAGCTATACTGGAAGCATGCGCCCAAGACCTGCAAGAACTTCGCGGAGCTGGCTCGGCGGGGCTACTACAATGGCACCAAGTTTCACCGGATCATCAAGGACTTCATGATCCAAGGCGGCGACCCGACAGGCACAGGTACACTTAAGCCACCATTGGGGAGGAACTGGGTGGTAAGGCAGCCACAGCT) with CRISPR/Cas9 technology, an AG-to-GC mutation (CT-to-GC on forward strand) was engineered to change arginine codon 55 (AGG) to an alanine codon (GCG) (p.R55A). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients. (J:300487)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count