Using a crRNA (targeting TCCCTATACCCTGGCACACT), a tracrRNA and an ssODN template (GGTCCTGGGAGTTTGTTTCCACCATGCCCACTCGATTCACCATCCCTATACCCTGGCACACTTGTCCAAAAATAGTATGCTTGCCGTCCAGCCATTGCGTGGGGGCCAGGGTCACAAAGAAC) with CRISPR/Cas9 technology, a single G-to-A mutation (C-to-T on forward strand) was engineered to change arginine codon 131 (CGA) to a glutamine codon (CAA) (p.R131Q). This mutation mimics a human mutation found in pontocerebellar hypoplasia plus microcephaly (PCHM) patients. (J:300487)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count